Darwin Unhinged: The Bugs in Evolution
1536 Replies, 269815 Views|
This post has been deleted.
An excellent summary of the current state of the debate between neo-Darwinism and Intelligent Design, adapted from https://uncommondescent.com/intelligent-...darwinism/ (9):
Quote:"Just try to find firm evidence of the Darwinian view of evolution. The Darwinists pull out their “best evidence”, and sure enough it turns out that:
2
A few years old but first time I'm seeing it ->
Seeing Emergent Physics Behind Evolution Jordana Cepelewicz Quote:His interest in emergent states of matter has compelled him to explore one of biology’s greatest mysteries: the origins of life itself. And he’s only branched out from there. “Physicists can ask questions in a different way,” Goldenfeld said. “My motivation has always been to look for areas in biology where that kind of approach would be valued. But to be successful, you have to work with biologists and essentially become one yourself. You need both physics and biology.” Quote:[The late biophysicist] Carl Woese and I felt that it was because it evolved in a different way. The way life evolves in the present era is through vertical descent: You give your genes to your children, they give their genes to your grandchildren, and so on. Horizontal gene transfer gives genes to an organism that’s not related to you. It happens today in bacteria and other organisms, with genes that aren’t really so essential to the structure of the cell. Genes that give you resistance to antibiotics, for example — that’s why bacteria evolve defenses against drugs so quickly. But in the earlier phase of life, even the core machinery of the cell was transmitted horizontally. Life early on would have been a collective state, more of a community held together by gene exchange than simply the sum of a collection of individuals. There are many other well-known examples of collective states: for example, a bee colony or a flock of birds, where the collective seems to have its own identity and behavior, arising from the constituents and the ways that they communicate and respond to each other. Early life communicated through gene transfer. Quote:It’s in that sense that I think our view of evolution as a process needs to be expanded — by thinking about dynamical systems, and how it is possible that systems capable of evolving and reproducing can exist at all. If you think about the physical world, it is not at all obvious why you don’t just make more dead stuff. Why does a planet have the capability to sustain life? Why does life even occur? The dynamics of evolution should be able to address that question. Remarkably, we don’t have an idea even in principle of how to address that question — which, given that life started as something physical and not biological, is fundamentally a physics question. That last link is to Jeremy England's ideas about how life arose...It's continuously amusing to me that physicalists reference England as if he wasn't a theist and an Orthodox Jew at that -> Quote:You are a physicist, working at the molecular level, making measurements. But you are also exploring the development of life. You sometimes describe some of your work as translation between biology and physics. Why is that?
'Historically, we may regard materialism as a system of dogma set up to combat orthodox dogma...Accordingly we find that, as ancient orthodoxies disintegrate, materialism more and more gives way to scepticism.'
(This post was last modified: 2021-03-11, 08:14 PM by Sci.)
- Bertrand Russell
2
(2021-03-11, 08:10 PM)Sciborg_S_Patel Wrote: A few years old but first time I'm seeing it ->Carl Woese's role in modern biology cannot be discounted. Quote: In the 1960s Carl was the first to have the idea that the genetic code we have is about as good as it could possibly be for minimizing errors. Even if you get the wrong amino acid — through a mutation, or because the cell’s translational machinery made a mistake — the genetic code specifies an amino acid that’s probably similar to the one you should have gotten. In that way, you’ve still got a chance that the protein you make will function, so the organism won’t die. David Haig [at Harvard University] and Laurence Hurst [at the University of Bath] were the first to show that this idea could be made quantitative through Monte Carlo simulation — they looked for which genetic code is most resilient against these kinds of errors. And the answer is: the one that we have. It’s really amazing, and not as well known as it should be. I identify with with the idea that the biological communication underlying living processes is sacred. Quote: He came, and during his talk he pointed to an “oligo spot” on a slide and said something like “this spot, the sequence AUUCCUUCCUUAUACAAUAAUUCCUAACUCUUAAAG (I just made that sequence up as poetic license), is found in all small ribosomal subunit RNAs,” at which point the audience tittered because he rattled off the exact sequence from memory. Carl heard the tittering and sternly admonished the audience to “not laugh at ribosomal RNA sequences because they are sacred.”https://www.pnas.org/content/110/9/3206.full
3
Now, a grand Darwinian experiment With 10,000 generations of yeast has proven that Michael Behe is right: Darwin devolves - Darwinian evolution is mostly about devolution (loss of function). To spell it out - it turns out that actual experiment with very many generations of yeast organisms shows that Darwinian evolution exclusively utilizing RM + NS does not and can not produce complex new genetic structures which in turn produce complex new body/behavior adaptations. It just sometimes adapts by breaking genes and reducing genetic complexity, not building new structures. The mystery of how complex genetic structures evolve is still a mystery, and appears to involve the interjection of outside intelligence.
This is a new research paper (at https://elifesciences.org/articles/63910), discussed here: Title: "Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populations". Note these quotes from the paper: “...populations predictably adapt through loss-of-function mutations”, and “We do not observe any populations that move from the lower fitness genotype to the higher fitness genotype even after 10,000 generations of evolution.” This is exactly as Behe predicted in his book "Darwin Devolves".
4
Finally, the nail on the coffin of Darwinism:
Paraphrased from https://uncommondescent.com/intelligent-...000-years/ and https://evolutionnews.org/2021/04/the-ca...e-nuclear/ . Quote:'It turns out that there was a 2018 paper ("New high‐resolution age data from the Ediacaran–Cambrian boundary indicate rapid, ecologically driven onset of the Cambrian explosion", https://onlinelibrary.wiley.com/doi/abs/.../ter.12368) about a study by a research group from the University of Zurich concerning the transition from the Ediacaran organisms to the Cambrian animal phyla in the Nama Basin of Namibia. What they found is truly mind-blowing. The window of time between the latest appearance date (LAD) of the alien Ediacaran biota and the first appearance date (FAD) of the complex Cambrian biota was only 410,000 years. You read that correctly, just 410 thousand years! This is not an educated guess but based on very precise radiometric U-Pb dating with an error margin of only plus-minus 200 thousand years. This precision is truly a remarkable achievement of modern science considering that we are talking about events 538 million years ago. Now it's not just isolated genes and protein folds. It's the entire genome of the multi-phylum array of Cambrian forms - an immense irreducibly complex system of complex specified genetic information on an array of new invertebrate (and some vertebrate) phyla appearing in 410,000 years, an eyeblink in evolution.
3
To me Stephen Meyer is brimming with quiet confidence.
Oh my God, I hate all this.
1
(2021-06-02, 06:47 PM)Stan Woolley Wrote: To me Stephen Meyer is brimming with quiet confidence. He is and I think it is justified. My only problem with him is that he tries to identify the designer in evolution as the God of the Scriptures. For many reasons I think that is unlikely. He doesn't recognize that there could be multiple designers (perhaps in the form of powerful spiritual entities nevertheless much lower in the hierarchy than God). Or other possibilities some of which we probably can't even imagine.
5
(2021-06-03, 03:07 AM)nbtruthman Wrote: He is and I think it is justified. My only problem with him is that he tries to identify the designer in evolution as the God of the Scriptures. For many reasons I think that is unlikely. He doesn't recognize that there could be multiple designers (perhaps in the form of powerful spiritual entities nevertheless much lower in the hierarchy than God). Or other possibilities some of which we probably can't even imagine. In one sense that may not matter. What does matter is not 'blind faith'', so much as a willingness to look at evidence. To the extent that his faith encourages him to look, makes him a seeker, that is positive. In the end most discoveries build upon the work of multiple people, each having a slightly different perspective. But very many of history's great scientists had some sort of religious belief, it often acted as a motivation. Modern narratives often prefer to whitewash those parts out, which may be a disservice.
3
|
|
« Next Oldest | Next Newest »
|
Users browsing this thread: 1 Guest(s)
![[-]](https://psiencequest.net/forums/images/collapse.png)