Psience Quest

(2021-02-16, 11:31 AM)nbtruthman Wrote: [ -> ]The problem of neural evolution...

A fundamental problem that has never been addressed by Darwinist evolutionary biologists and theorists: developing the DNA encoding changes for the intricate neural programs for new instinctual abilities required by physical evolution. A good example is bird flight, where somehow from random mutations millions of neurons had to be increased in number and reorganized into the extremely complex brain structures implementing the necessary new functional algorithms. The problem is actually greater and more complex than developing the new physical structures:

A few notes on the complexity of the neural systems required for the bird to fly that had to be evolved somehow from random mutations and other genetic changes (or more likely designed), based on the design of human-designed autopilots. A very difficult and problematic area that has been (I'm sure deliberately) left out of Darwinist evolutionary theorizing and "just so stories".

An autopilot is a device that must be capable of accomplishing all types of controlling functions including automatic take-off (in UAVs), flying toward the target destination, performing mission operations (e.g., surveillance in UAVs), and automatic landing. The autopilot has the responsibility for: (1) stabilizing the vehicle (two or three axis gyroscopic stabilization), (2) tracking and in some UAVs attack based on commands (in the bird from higher (conscious) neural structures), (3) following guidance (consciousness neural centers in the bird), and (4) navigating to destinations (in the bird combining terrain following, magnetic north sensing and at-night stellar navigation, also involving consciousness).

The two-axis autopilot system installed in most general aviation aircraft controls the pitch and roll of the aircraft. The autopilot can operate independently, controlling
heading and altitude, or it can be coupled to a navigation system and fly a programmed course or an approach with glideslope. The bird has to have a 3-axis system (including yaw or heading).

Autopilots can automate tasks, such as maintaining an altitude, climbing or descending to an assigned altitude, turning to and maintaining an assigned heading, intercepting a course, guiding the aircraft between waypoints that make up a programmed route. Of course the route plan in the bird has to be some sort of higher neural processing center associated with consciousness.

Many advanced avionics installations really include two different, but integrated, systems. One is the autopilot system, which is the set of servo actuators that actually do
the control movements and the control circuits to make the servo actuators move the correct amount for the selected task. The second is the flight director (FD) component. The
FD is the brain of the autopilot system. 

The bird has to have both systems implemented in intricate neural structures combined with extensive modifications to the motor areas, in which the FD system includes the consciousness component.

Hey all, been on hiatus for a while. As such, have had quite a bit of personal and all kinds of development.

Regarding this topic, here are my current thoughts on the subject.

Let's start with this analogy - life as universe "observers" traversing all potential potentialities of what can be (aka reference frames in physics). This might be likened to traversing a multidimensional maze.

The creationist would be (incorrectly IMO) arguing that instead of traversing a path from origin to the current location in the maze, instead there have been jumps in the path.

The materialist would correctly see the path back to the origin. But, they would not understand that the path which was chosen was not random, but rather selected by the observer, which does not necessarily think in the same terms as a modern-day human. The materialist is inexorably tied to Maya, the great illusion, which is an extension of the self, the observable through one's reference frame. To transcend beyond this, we need to be comfortable with the fundamentally unknowable. Pure potential, and this is where quantum comes into play (in a non-woo sense, meaning it can be applied to one's life in a useful way).

I suspect that the answer to this question, when fully understood, will show us what it means to be alive, to be human - and it will be quite exciting.

An excellent summary of the current state of the debate between neo-Darwinism and Intelligent Design, adapted from https://uncommondescent.com/intelligent-...darwinism/ (9):

Quote:"Just try to find firm evidence of the Darwinian view of evolution. The Darwinists pull out their “best evidence”, and sure enough it turns out that:
– it is mostly adaptation and microevolution (beak sizes, moth colours), or
– it is clearly devolution (polar bears, blind fish, etc.), or
– it fits better with Intelligent Design (i.e. the mostly transitional form-free fossil record, especially the Cambrian Explosion), or
– it is a non credible just-so story (like whale “evolution”), or
– it is some hand-waving, simplified speculation, or simplistic “model”.
A challenge to the Darwinists (and also just to the doubters that there must be some sort of intelligence behind evolution): If you have any – ANY – actual evidence of Darwinistic macroevolution, feel free to offer it, with a link so we can read and learn!"

A few years old but first time I'm seeing it ->

Seeing Emergent Physics Behind Evolution

Jordana Cepelewicz

Quote:His interest in emergent states of matter has compelled him to explore one of biology’s greatest mysteries: the origins of life itself. And he’s only branched out from there. “Physicists can ask questions in a different way,” Goldenfeld said. “My motivation has always been to look for areas in biology where that kind of approach would be valued. But to be successful, you have to work with biologists and essentially become one yourself. You need both physics and biology.”

Quote:[The late biophysicist] Carl Woese and I felt that it was because it evolved in a different way. The way life evolves in the present era is through vertical descent: You give your genes to your children, they give their genes to your grandchildren, and so on. Horizontal gene transfer gives genes to an organism that’s not related to you. It happens today in bacteria and other organisms, with genes that aren’t really so essential to the structure of the cell. Genes that give you resistance to antibiotics, for example — that’s why bacteria evolve defenses against drugs so quickly. But in the earlier phase of life, even the core machinery of the cell was transmitted horizontally. Life early on would have been a collective state, more of a community held together by gene exchange than simply the sum of a collection of individuals. There are many other well-known examples of collective states: for example, a bee colony or a flock of birds, where the collective seems to have its own identity and behavior, arising from the constituents and the ways that they communicate and respond to each other. Early life communicated through gene transfer.

Quote:It’s in that sense that I think our view of evolution as a process needs to be expanded — by thinking about dynamical systems, and how it is possible that systems capable of evolving and reproducing can exist at all. If you think about the physical world, it is not at all obvious why you don’t just make more dead stuff. Why does a planet have the capability to sustain life? Why does life even occur? The dynamics of evolution should be able to address that question. Remarkably, we don’t have an idea even in principle of how to address that question — which, given that life started as something physical and not biological, is fundamentally a physics question.

That last link is to Jeremy England's ideas about how life arose...It's continuously amusing to me that physicalists reference England as if he wasn't a theist and an Orthodox Jew at that ->

Quote:You are a physicist, working at the molecular level, making measurements. But you are also exploring the development of life. You sometimes describe some of your work as translation between biology and physics. Why is that?
 
This idea of translation between two different scientific fields was actually, in many ways, born out of my study of Torah. Around the time of my postdoc I was thinking about parashat Bereishit (Genesis). One thing you can pull out of the opening passage in Bereishit is that the process of creation of the world is part and parcel to the way we talk about it. The light by which we see the world comes from the way we talk about it—that is true for Ha-kadosh baruch hu  and it is true for us because we are b’tzelem Elohim [created in the image of God]. That idea really helped me clarify my own thinking—the understanding that biology and physics are different languages for talking about the world.

(2021-03-11, 08:10 PM)Sciborg_S_Patel Wrote: [ -> ]A few years old but first time I'm seeing it ->

Seeing Emergent Physics Behind Evolution

Jordana Cepelewicz


That last link is to Jeremy England's ideas about how life arose...It's continuously amusing to me that physicalists reference England as if he wasn't a theist and an Orthodox Jew at that ->

Carl Woese's role in modern biology cannot be discounted.

Quote: In the 1960s Carl was the first to have the idea that the genetic code we have is about as good as it could possibly be for minimizing errors. Even if you get the wrong amino acid — through a mutation, or because the cell’s translational machinery made a mistake — the genetic code specifies an amino acid that’s probably similar to the one you should have gotten. In that way, you’ve still got a chance that the protein you make will function, so the organism won’t die. David Haig [at Harvard University] and Laurence Hurst [at the University of Bath] were the first to show that this idea could be made quantitative through Monte Carlo simulation — they looked for which genetic code is most resilient against these kinds of errors. And the answer is: the one that we have. It’s really amazing, and not as well known as it should be. 

I identify with with the idea that the biological communication underlying living processes is sacred.

Quote: He came, and during his talk he pointed to an “oligo spot” on a slide and said something like “this spot, the sequence AUUCCUUCCUUAUACAAUAAUUCCUAACUCUUAAAG (I just made that sequence up as poetic license), is found in all small ribosomal subunit RNAs,” at which point the audience tittered because he rattled off the exact sequence from memory. Carl heard the tittering and sternly admonished the audience to “not laugh at ribosomal RNA sequences because they are sacred.”

https://www.pnas.org/content/110/9/3206.full

Now, a grand Darwinian experiment With 10,000 generations of yeast has proven that Michael Behe is right: Darwin devolves - Darwinian evolution is mostly about devolution (loss of function). To spell it out - it turns out that actual experiment with very many generations of yeast organisms shows that Darwinian evolution exclusively utilizing RM + NS does not and can not produce complex new genetic structures which in turn produce complex new body/behavior adaptations. It just sometimes adapts by breaking genes and reducing genetic complexity, not building new structures. The mystery of how complex genetic structures evolve is still a mystery, and appears to involve the interjection of outside intelligence.

This is a new research paper (at https://elifesciences.org/articles/63910), discussed here: Title: "Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populations". Note these quotes from the paper: “...populations predictably adapt through loss-of-function mutations”, and “We do not observe any populations that move from the lower fitness genotype to the higher fitness genotype even after 10,000 generations of evolution.” This is exactly as Behe predicted in his book "Darwin Devolves".

Stephen Meyer

Finally, the nail on the coffin of Darwinism:

Paraphrased from https://uncommondescent.com/intelligent-...000-years/ and https://evolutionnews.org/2021/04/the-ca...e-nuclear/ .

Quote:'It turns out that there was a 2018 paper ("New high‐resolution age data from the Ediacaran–Cambrian boundary indicate rapid, ecologically driven onset of the Cambrian explosion", https://onlinelibrary.wiley.com/doi/abs/.../ter.12368) about a study by a research group from the University of Zurich concerning the transition from the Ediacaran organisms to the Cambrian animal phyla in the Nama Basin of Namibia. What they found is truly mind-blowing. The window of time between the latest appearance date (LAD) of the alien Ediacaran biota and the first appearance date (FAD) of the complex Cambrian biota was only 410,000 years. You read that correctly, just 410 thousand years! This is not an educated guess but based on very precise radiometric U-Pb dating with an error margin of only plus-minus 200 thousand years. This precision is truly a remarkable achievement of modern science considering that we are talking about events 538 million years ago.

Paleontologists have tried to explain the absence of soft-bodied ancestors in pre-Cambrian sediments as artifacts of preservation. No longer. This hypothesis has been refuted by evidence from pre-Cambrian fossil sites of the Burgess Shale type (known to be able to produce masses of invertebrate fossils) in Mongolia and China. They yielded nothing but fossil algae.

This and especially the 2018 study by Lindemann has made the problem of the Cambrian Explosion for Darwinism much much more acute: 537.6 million years ago there were no animals at all, and 538.0 million years ago there were already fully developed crown-group arthropods like trilobites with sophisticated compound eyes, exoskeletons, and articulated legs. Does anybody seriously believe that such an enormous transition within 410,000 years, is a piece of cake for the undirected semi-random walk Darwinistic process?

“Charles Darwin said (paraphrase), ‘If anyone could find anything that could not be had through a (large and very lengthy timewise and intermediate species-wise) number of slight, successive, modifications, my theory would absolutely break down.’ Well that condition has been met time and time again. Basically every gene, every protein fold. There is nothing of significance that we can show that can be had in a gradualist way. It’s a mirage. None of it happens that way.”
– Doug Axe PhD. – quoted from video interview, https://www.metacafe.com/watch/5347797/.'

Now it's not just isolated genes and protein folds. It's the entire genome of the multi-phylum array of Cambrian forms - an immense irreducibly complex system of complex specified genetic information on an array of new invertebrate (and some vertebrate) phyla appearing in 410,000 years, an eyeblink in evolution.

To me Stephen Meyer is brimming with quiet confidence. 

(2021-06-02, 06:47 PM)Stan Woolley Wrote: [ -> ]To me Stephen Meyer is brimming with quiet confidence. 

He is and I think it is justified. My only problem with him is that he tries to identify the designer in evolution as the God of the Scriptures. For many reasons I think that is unlikely. He doesn't recognize that there could be multiple designers (perhaps in the form of powerful spiritual entities nevertheless much lower in the hierarchy than God). Or other possibilities some of which we probably can't even imagine.